Site Loader
Get a Quote
Rock Street, San Francisco

Total RNA was extracted from 100 mg of leaf tissues from BBrMV infected and healthy plants using total plant RNA extraction Kit (Sigma Aldrich, USA) according to the manufacturer’s instructions. The first strand cDNA was synthesized using Revertaid First Strand cDNA Synthesis Kit (Thermo Scientific, USA). Polymerase chain reaction was performed using BBrMV capsid protein (CP) gene specific primer pair (RS10FP: 5’ATAGGATCCTCTGGAACGGAGTCAACC3′) and reverse primer (RS10RP 5’TTAGTCGACTTCATGTTTCATCCCAAGCAGAG3′); the resulting PCR products were digested with Bam HI and Sal I and inserted into the same sites of the prokaryotic expression vector, pET28a (+) (Novagen, Darmstadt, Germany). The construct was sequenced and then transferred into Escherichia coli strain BL21 (DE3).
The E. coli BL21(DE3) strain containing the pET28a-BBrMVCP was grown overnight in 5 ml of Luria broth at 37 °C and induced for expression by adding 0.1 mM Isopropyl ?-D-1-thiogalactopyranoside (IPTG) to the 0.6 OD broth culture for 3 h with vigorous shaking at 200 rpm. The bacterial cells were collected by centrifuging at 10,000 rpm at 4 °C for 10 min, dissolved in 0.01 M phosphate buffer (pH 7.4). and the samples were sonicated for 5 min on ice bath, for ten passes of 30 s. The soluble and insoluble fractions were separated by centrifuging the total bacterial lysates at 10,000 rpm at 4 °C for 20 min and resolved in 12 % SDS-PAGE. The gels were stained for proteins with Coomassie Brilliant blue (R250) in 50 % (v/v) methanol and 10 % (v/v) acetic acid. The insoluble sonicated fraction containing the expressed protein obtained from one liter of 3 h induced bacterial culture was dissolved in 6 M urea. The protein was purified using Ni-NTA column chromatography (Novagen, Darmstadt, Germany) as per manufacturer’s protocol. Thepurified protein was dialyzed using dialysis membrane (MWCO 12,000–14,000 Da) to remove the salt impurities with continuous stirring for 24 h in 20 mM Tris–HCl with 0.5 M NaCl (pH 7.9).
To test the purified recombinant BBrMV-CP can be recognized by anti- CP antibodies, 100 ng of the purified recombinant BBrMV-CP was resolved in 12 % SDS-PAGE and electro blotted on to PVDF membrane (Sigma, USA) using semi dry blotting apparatus (Bio-Rad, USA) at 15 volts for 30 min. Western blot was carried out with anti-BBrMV-CP antibodies. Crude extracts from BBrMV-infected and healthy banana leaf tissues were used as positive and negative control respectively.

A purified BBrMV- CP was given for customised production of polyclonal antibody in rabbit (Abgenex Pvt. Ltd., Bhubaneswar India). The purified recombinant BBrMV- CP protein (800 µg) was emulsified with an equal volume of Freund’s incomplete adjuvant and injected intramuscularly into a New Zealand white rabbits weekly for five weeks. Rabbit was bled one week after fifth injection. Two-booster injections with 1 mg of protein each time was given after first bleed. Two more bleeds were collected at weekly intervals after each booster injection. The antiserum was clarified by centrifuging at 3420 × g for 2 min and stored at -80 °C with 50 % glycerol. Immunoglobulins (IgG) were isolated by protein A affinity column (Thermo Scientific, USA) chromatography.
Flat-bottomed polystyrene microtitre plate (Nunc, New York, USA) was coated with 200 µl of leaf extracts prepared in carbonate buffer containing 2 % polyvinyl pyrrolidone (PVP) and incubated overnight at 4 °C. The coated plates were washed thrice with PBST (PBS containing 0.05% (v/v) Tween-20, pH 7.4) and blocked with 200 µl of 1% bovine serum albumin (BSA) in PBS (at 37 °C) for 1 h. After three washes, 200 µl of polyclonal antiserum diluted with 1% BSA in PBST (1:1000) was added to each well of the plate; then, the plate was incubated for 2 h at 37 °C. Plate was washed thrice and 200 µl of alkaline phosphatase-conjugated secondary goat anti-rabbit antibody (Sigma Aldrich, St. Louis, USA) diluted in antibody dilution buffer (2% PVP and 0.2% BSA in PBS-T) (1:30,000) was added to each well of the plate, and the plate was then incubated at 37 °C for 2 h. The plate was washed three times, and then 200 µl of the 1 mg/ml pNPP-Na (Sigma, Aldrich, St. Louis, USA) in substrate buffer (10% diethanolamine and 0.004% MgCl2) was added to each well of the plate for color development. The color development was stopped with 5N NaOH (50 µl per well). After 10–20 min, the absorbance was measured in single-wavelength mode at 405 nm using Synergy H1 Microplate Reader (BIO-TEK Instruments Inc., Winooski, VT, USA). This assay was carried out in three replicates.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

Post Author: admin

x

Hi!
I'm Lillian

Would you like to get a custom essay? How about receiving a customized one?

Check it out